20210430

Contents

1. 1. Working directories
   1. 1.1. CRAN
   2. 1.2. One-Step PCR To Distinguish B Virus from Related Primate Alphaherpesviruses

Working directories

bioawk -c fastx 'length($seq) > 100{ print ">"$name; print $seq }'  input.fasta

---

cd /media/ht/ht_5T/Database/Virus/Herpesvirus/HSV
i='HSV-1.fasta'
bioawk -c fastx 'length($seq) > 100000{ print ">"$name; print $seq }' ${i} > `TS`.fas
i='HSV-2.fasta'
bioawk -c fastx 'length($seq) > 100000{ print ">"$name; print $seq }' ${i} > `TS`.fas

• bioawk_Learning.md

CRAN

install.packages(c("bitops", "brglm", "DT", "haven", "highr", "knitr", "RcppArmadillo", "recipes"))
#
i <- "DiagrammeR"
install.packages(i)
#
i <- "DiagrammeR"
install.packages(i, dependencies = TRUE)
#

```{r diagram-mermaid, echo = FALSE, warning = FALSE, message = FALSE}

• DiagrammeR - Documentation

also installing the dependencies ‘curl’, ‘httr’, ‘V8’, ‘igraph’, ‘influenceR’, ‘viridis’, ‘covr’, ‘DiagrammeRsvg’, ‘rsvg’

also installing the dependencies
“clipr”, “viridisLite”, “ggplot2”, “gridExtra”, “downloader”, “igraph”, “influenceR”, “readr”, “tidyr”, “viridis”, “visNetwork”

One-Step PCR To Distinguish B Virus from Related Primate Alphaherpesviruses

gGS4_F
CCGCGTACGACTACGAGATCC
gGAS4_R
GTTCGCGGCCACGATCCA

From
One-Step PCR To Distinguish B Virus from Related Primate Alphaherpesviruses

Detection of BV and other alphaherpesviruses by PCR. (A) PCR with primers gGS4 (forward, 5′-CCGCGTACGACTACGAGATCC-3′) and gGAS4 (reverse, 5′-GTTCGCGGCCACGATCCA-3′) in the presence of 1.5 M betaine. After an initial denaturation step (94°C, 5 min), PCR was conducted for 35 cycles (94°C, 1 min; 55°C, 1 min; 72°C, 2 min), followed by a final extension (72°C, 7 min). PCR products were subjected to electrophoresis on a 5% polyacrylamide gel, and DNA bands were visualized under illumination at 254 nm after being stained with SYBR Green I (9). The arrow at the right indicates the position of the 209-bp fragment in lanes 1 and 3. (B) PCR with primers BV1 and BV2 tested according to the method of Scinicariello et al. (16, 17). The arrow indicates the 128-bp fragment. Lane M, _Hae_III-digested φX174 replicative form (RF) DNA. Lanes 1 to 4, BV DNA as the PCR template. Lane 1, strain E2490 (rhesus macaque); lane 2, strain E90-136 (cynomolgus macaque); lane 3, strain 8100812 (lion-tailed macaque); lane 4, strain Kumquat (pigtail macaque); lanes 5 to 8, DNA of primate alphaherpesviruses other than BV as the PCR template; lane 5, human HSV-1 (strain KOS); lane 6, human HSV-2 (strain 186); lane 7, SA8 (strain B264) of green monkeys; lane 8, HVP2 (strain OU1-76) of baboons.

赏

谢谢你请我吃糖果